View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19380_low_41 (Length: 395)
Name: NF19380_low_41
Description: NF19380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19380_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 9 - 210
Target Start/End: Complemental strand, 8404553 - 8404352
Alignment:
| Q |
9 |
gaagaatatgaagtcgggtctgatttagcagcaatatggtgtggatatcgcggttgacgaggttgatttctctgcgggggttgggaattagtaccatagt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8404553 |
gaagaatatgaagtcgggtctgatttagcagcaatatggtgtggatatcgcggttgacgaggttgatttctctgggggggttgggaattagtaccatagt |
8404454 |
T |
 |
| Q |
109 |
cataagagataggtactctgttgtcgtgtggtttggtgaagcagtgtcccatgttgaatgatgtttgttgatggagagattgatttgtgacttgaagggt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8404453 |
cataagagataggtactctgttgtcgtgtggtttggtgaagcagtgtcccatgttgaatgatgtttgttgatggagagattgatttgtgacttgaagggt |
8404354 |
T |
 |
| Q |
209 |
gt |
210 |
Q |
| |
|
|| |
|
|
| T |
8404353 |
gt |
8404352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 291 - 378
Target Start/End: Complemental strand, 8404271 - 8404184
Alignment:
| Q |
291 |
ctttgcttttttcttgggttgggatggtcctcacatagtcacatagcataaaagcaatattcctttctttttgcattagtacgctttg |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8404271 |
ctttgcttttttcttgggttgggatggtcctcacatagtcacatagcataaaagcaatattcctttctttttgcattagtacgctttg |
8404184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University