View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19380_low_42 (Length: 392)
Name: NF19380_low_42
Description: NF19380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19380_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 12 - 297
Target Start/End: Complemental strand, 34312931 - 34312642
Alignment:
| Q |
12 |
gagcacagatggaaatgactatgtgatgaagcttcattgaggtagtcatgaagaaaaagggaaaatagagggttgagtgattgttaaaggggtaggagtg |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34312931 |
gagcacaaatggaaatgactatgtgatgaagcttcattgaggtagtcatgaagaaaaagggaaaatagagggttgagtgattgttaaaggggtaggagtg |
34312832 |
T |
 |
| Q |
112 |
gcttatttatagtgtattggcgtggtttaaaaattgagtacattactccctcatcctatcaaattaagtatattacaacccccacctcatgttttaaaac |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| || | |||||||||||||||| |
|
|
| T |
34312831 |
gcttatttatagcgtattggcgtggtttaaaaattgagtacattactccctcatcctttcaaactaagtatattacaatccgctcctcatgttttaaaac |
34312732 |
T |
 |
| Q |
212 |
atgccctaccctcctttttgatattgaggaggaacacactctcaagtcaat----atcatcagatcaaatcaagtcggtctaaacttaca |
297 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||| ||| |||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
34312731 |
atgcactaccctcctttttgatcttgaggaggaatacattctcaagtcaatatacatcatcagatcaaatcaagtcgatctaaacttaca |
34312642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University