View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19380_low_60 (Length: 305)
Name: NF19380_low_60
Description: NF19380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19380_low_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 18 - 299
Target Start/End: Complemental strand, 49293357 - 49293080
Alignment:
| Q |
18 |
agtggttcctcatgaacacgacgaggagtttcatatgttagcattcctattgtttgtgaaggcttgtttagtctttgttggcatcaccttattgaagttg |
117 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49293357 |
agtggttcctcataaacactacgaggagtttcatatgttagcattcctattgtttgtgaaggcttgtttagtctttgttggcatcaccttattgaagttg |
49293258 |
T |
|
| Q |
118 |
acgacgacagttcaaccaaaatgccaagactcttttaagatctcaagtgcatacaccaaacatagttttgatatggagaattgaaattttcatgggtgcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49293257 |
acgacgacagttcaaccaaaatgccaagactcttttaagatctcaagtgcatacaccaaacatagttttgatatggagaattgaaattttcatgggtgcc |
49293158 |
T |
|
| Q |
218 |
aaatttattgtcatactagagatttagcctaggtatatatgggttgatagtccttcactgtgattctctttattcaatctat |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49293157 |
aaatttattgtcatactagagatttagcctagg----tatgggttgatagtcctcaactgtgattctctttattcaatctat |
49293080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 137 - 192
Target Start/End: Complemental strand, 17919413 - 17919358
Alignment:
| Q |
137 |
aatgccaagactcttttaagatctcaagtgcatacaccaaacatagttttgatatg |
192 |
Q |
| |
|
|||| ||||| ||||| ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
17919413 |
aatgacaagattctttgtagatctcaagtgcatacgccaaacatagtcttgatatg |
17919358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University