View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19380_low_63 (Length: 280)
Name: NF19380_low_63
Description: NF19380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19380_low_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 227
Target Start/End: Original strand, 42917101 - 42917311
Alignment:
| Q |
17 |
accctctccattccatttcccccaattccacaaatcaacgatggttacttgcaattccatttccctttctcacaatctccatttccataccagatttcat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42917101 |
accctctccattccatttcccccaattccacaaatcaacgatggttacttgcaattccatttccctttctcacaatctccatttctataccagatttcat |
42917200 |
T |
|
| Q |
117 |
cgccttcacccgacgcggcgttctcattattgccgttttcgttccaatgctctcccaagtaattcatcctctctttaatttcacgcttctaccatttcaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42917201 |
cgccttcacccgacgcggcgttctcattattgccgttttcgttccaatgctctcccaagtaattcatcctctctttaatttcactcttctaccatttcaa |
42917300 |
T |
|
| Q |
217 |
ttacggaacaa |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
42917301 |
ttacggaacaa |
42917311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University