View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19380_low_66 (Length: 255)
Name: NF19380_low_66
Description: NF19380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19380_low_66 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 22 - 255
Target Start/End: Original strand, 21612282 - 21612508
Alignment:
| Q |
22 |
taaacttataatttgtgtaaaataaaataaacttataattcaataataaagatttctatatgaatttcggttgagtctaattgaaatccttcgaccaaca |
121 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21612282 |
taaacttataatttgtgtacaataaaataaacttataattcaataataaatatttgtatatgaatttcggttgagtctaattgaaatccttcgaccaaca |
21612381 |
T |
 |
| Q |
122 |
caacatgctactatgatatgttgatcatatg-nnnnnnnnnacggactggctaagttgttgattagctattatatttataaatctaacagttaacgttaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21612382 |
caacatgctactatgatatgttgatcatatgttttttttttacggaccggctaagttgttgattagctattatatttataaatc-------taacgttaa |
21612474 |
T |
 |
| Q |
221 |
attgtacttcccccgtttatacgataagaaacaat |
255 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |
|
|
| T |
21612475 |
attgtactt-ccccgtttttacgataagaaacaat |
21612508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University