View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19380_low_75 (Length: 232)
Name: NF19380_low_75
Description: NF19380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19380_low_75 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 39925049 - 39925254
Alignment:
| Q |
1 |
ctgactttaatttatatggatatttttcataagtatagtacagtgtttatatgtattttacggttagtatgg--nnnnnnnnnnnngcttgcgtgacaaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
39925049 |
ctgactttaatttatatggatatttttcataagtatagtacagtgtttatatgtattttacggctagtatggatatatatgtatatgcttgcgtgacaaa |
39925148 |
T |
 |
| Q |
99 |
taatgtagatgaataaatgtagtagcgtgaggactaaggagggaaagtgctgttcgagaaggtatagacattattaagaaaagaggcatgttacttgcat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||| |
|
|
| T |
39925149 |
taatgtagatgaataaatgtagtagcgtgaggactaaggagggaaagtgcag------------------taattaagaaaagaggcatgttacttgcat |
39925230 |
T |
 |
| Q |
199 |
ttcatctaattctttctttttcat |
222 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
39925231 |
ttcacctaattctttctttttcat |
39925254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University