View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19380_low_76 (Length: 230)
Name: NF19380_low_76
Description: NF19380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19380_low_76 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 20 - 210
Target Start/End: Original strand, 15147012 - 15147202
Alignment:
| Q |
20 |
atataaatcgtaatatgaaagcaataataaaactaaccaaattgtgatgtgtaaataaaattatatacctaaggttgttcaaaaaactgaaatggttcta |
119 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15147012 |
atataaatcggagtatgaaagcaataataaaactaaccaaattgtgatgtgtaaataaaattatatacctaaggttgttcaaaaaactgaaatggttcta |
15147111 |
T |
 |
| Q |
120 |
agcacatgcacatgttatcaccagtacaaatcactgttagaggaagtggacaattttcgggattacactctatttcatcattgcaatataa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15147112 |
agcacatgcacatgttatcaccagtacaaatcactgtcagaggaagtggacaattttcgggattacactctatttcatcattgcaatataa |
15147202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University