View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19380_low_77 (Length: 229)

Name: NF19380_low_77
Description: NF19380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19380_low_77
NF19380_low_77
[»] chr5 (2 HSPs)
chr5 (54-176)||(35274873-35274995)
chr5 (1-32)||(35275020-35275051)


Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 54 - 176
Target Start/End: Complemental strand, 35274995 - 35274873
Alignment:
54 aaagagataaattggtctatttcctaaataggaaatttgtgaatgaagttaatgattctataacacaaacccgtggcactagtttgagaccaaagaaaca 153  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35274995 aaagagataaattggtctatttcctaaataggaaatttgtgaatgaagttaatgattctataacacaaacccgtggcactagtttgagaccaaagaaaca 35274896  T
154 ttacaacttcactacttttgatg 176  Q
    |||||||||||||||||||||||    
35274895 ttacaacttcactacttttgatg 35274873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 35275051 - 35275020
Alignment:
1 actgaatgataattataaagagatgttataaa 32  Q
    ||||||||||||||||||||||||||||||||    
35275051 actgaatgataattataaagagatgttataaa 35275020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University