View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19381_high_24 (Length: 311)
Name: NF19381_high_24
Description: NF19381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19381_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 9 - 147
Target Start/End: Complemental strand, 30479463 - 30479325
Alignment:
| Q |
9 |
atcacatttcgtggctttgtgcatgctattcaatgcatttatgcttttatgacaaatttcaattcgacaatttactcttatgtgagttgtagttctatac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30479463 |
atcacatttcgtggctttgtgcatgctatgctatgcatttatgcttttatgacaaatttcaattcgacaatttactcttatgtgagttgtagttctatac |
30479364 |
T |
|
| Q |
109 |
attgcttcttgtaccaacaaaacgataaatacaataact |
147 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
30479363 |
attgcttcttgtaccaacaaaacaataaatacaacaact |
30479325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 264
Target Start/End: Complemental strand, 15873906 - 15873854
Alignment:
| Q |
212 |
actaattaaagaaataaatataataaaaatatcttgaaacttatgtcatcaaa |
264 |
Q |
| |
|
|||| ||||||||| ||||||||||| ||| ||||||||||| ||| |||||| |
|
|
| T |
15873906 |
actagttaaagaaacaaatataataagaatttcttgaaacttgtgtaatcaaa |
15873854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University