View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19381_high_27 (Length: 298)
Name: NF19381_high_27
Description: NF19381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19381_high_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 16 - 298
Target Start/End: Complemental strand, 37145943 - 37145661
Alignment:
| Q |
16 |
caaatgataggaatgtttcaagtgctaccaaggctcgtagtgttcgatctagattatactctttggcctttctactggtaaatttgtacatgatacatct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37145943 |
caaatgataggaatgtttcaagtgctaccaaggctcgtagtgttcgatctagattatactctttggcctttctactggtaaatttgtacatgatacatct |
37145844 |
T |
 |
| Q |
116 |
tttcatctttactattttctggagtacccactaaactttctttcttatcatgtatttgactacaccaattgaatctcaaatttcagtgagtgccgctcca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37145843 |
tttcatctttactattttctggagtacccactaaactttctttcttatcatgtatttgactacaccaattgaatctcaaatttcagtgagtgccgctcca |
37145744 |
T |
 |
| Q |
216 |
agcacgacacaccttctttgtttccccattccagaggcatcttgagtgcactcaaagatgaaggaattgatgctgcctttgct |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37145743 |
agcacgacacaccttctttgtttccccattccagaggcatcttgagtgcactcaaagatgaaggaattgatgctgccattgct |
37145661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University