View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19381_high_31 (Length: 269)
Name: NF19381_high_31
Description: NF19381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19381_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 13 - 252
Target Start/End: Complemental strand, 37898719 - 37898480
Alignment:
| Q |
13 |
aatataattgagtgatgaggaaactatgttggagacttattaactagattggggaattcatagaggccattcagtccaagacctcatgtgaaccctgaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37898719 |
aatataattgagtgatgaggaaactatgttggagacttattaactagattggggaattcatacaggccattcagtccaagacctcatgtgaaccctgaga |
37898620 |
T |
 |
| Q |
113 |
tttgacccgacaaaaatcataatggagtccaaaacaaacaaccagttttgtgtgaattagctgaaactgatatcattccttgtagtaaaggggacatgaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37898619 |
tttgacccgacaaaaatcataatggagtccaaaacaaacaaccagttttgtgtgaaatagctgaaactgatatcattccttgtagtaaaggggacatgaa |
37898520 |
T |
 |
| Q |
213 |
gaagagtagttcatttgaactaagccatcaatcttgaaca |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37898519 |
gaagagtagttcatttgaactaagccatcaatcttgaaca |
37898480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 57 - 107
Target Start/End: Complemental strand, 42447251 - 42447201
Alignment:
| Q |
57 |
tagattggggaattcatagaggccattcagtccaagacctcatgtgaaccc |
107 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||| | ||||||| |
|
|
| T |
42447251 |
tagattggggaattcatacaggccatccagtccaagacctcgtatgaaccc |
42447201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University