View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19381_low_25 (Length: 315)
Name: NF19381_low_25
Description: NF19381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19381_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 306
Target Start/End: Original strand, 10810175 - 10810480
Alignment:
| Q |
1 |
tagacaatgtttggatcttaaaatggtatttgatattgaaacgttaagctatcatattactttaaaaggcattacgtaaaggcttagagtaacacctaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10810175 |
tagacaatgtttggatcttaaaatggtatttgatattgaaacgttaagctatcatattgctttaaaaggcattacgtaaaggcttagagtaacacctaaa |
10810274 |
T |
 |
| Q |
101 |
ttgatccttccttttgtcattgtattacgtaaaggtttaggagtattatggttttgattttgaagtataaacacgttaatgtaacatcaaatgagcttta |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10810275 |
tcgatccttccttttgtcattgtattacgtaaaggtttaggagtattatggttttgattttgaagtataaacacgttaatgtaacatcaaatgagcttta |
10810374 |
T |
 |
| Q |
201 |
tatatcttttatacactaaaattattgtaatacagtgaaaaaatagagaggatataggtaggatccttgcatattaattagtccttagatagaaggtgag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10810375 |
tatatcttttatacactaaaattattgtaatacagtgaaaaaatagagaggataaaggtaagatccttgcatattaattagtccttagatagaaggtgag |
10810474 |
T |
 |
| Q |
301 |
tattat |
306 |
Q |
| |
|
|||||| |
|
|
| T |
10810475 |
tattat |
10810480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University