View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19381_low_34 (Length: 266)
Name: NF19381_low_34
Description: NF19381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19381_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 14513239 - 14512984
Alignment:
| Q |
1 |
cttcttcaaaccaagtaactatcagtgttgttctctcagtagctattgctgttttcttatttcccactatccagcgccgaatcaaaagagcaaaacaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14513239 |
cttcttcaaaccaagtaactatcagtgttgttctctcagtagctattgctgttttcttatttcccactatccagcgccggatcaaaagagcaaaacaatt |
14513140 |
T |
 |
| Q |
101 |
ggtatgttttgttgttgtatattctgannnnnnnnaatcattcaatttatggtaatttgacaatttatctccatgtgtgttctgttttaagatataaaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14513139 |
ggtatgttttgttgttgtatattctgattttatttattcattcaatttatggtaatttgacaatttatctccatgtgtgttctgttttaagatataaaca |
14513040 |
T |
 |
| Q |
201 |
--tgtatgtgtagtttgacgatttttcaaattttctcttttttattggaatatttt |
254 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14513039 |
tgtgtgtgtgtagtttgacgatttttcaaattttctcttttttattggaatatttt |
14512984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University