View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19381_low_37 (Length: 251)
Name: NF19381_low_37
Description: NF19381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19381_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 232
Target Start/End: Complemental strand, 10810101 - 10809880
Alignment:
| Q |
11 |
tctacacacttcttcagagacttactagttttaagtgttaacgttatcacgtaaaccaaatataaaatatacatagtacagtaactggcccgttgcaaca |
110 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10810101 |
tctacacacttcttcggagacttactagttttaagtgttaacgttatcacgtaaaccaaatataaaatatacatagtacagtaactggcccgttgcaaca |
10810002 |
T |
 |
| Q |
111 |
tgcaacttgcagtttttcgtggtcccaaacttgaaacaaaaggctccaataacagtacctaaatttgcaagggtccccacttcaatgtaatgaaatgata |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10810001 |
tgcaacttgcagtttttcgtggtcccaaacttgaaacaaaaggctccaataacagtacctgaatttgcaagggtccccacttcaatgtaatgaaatgata |
10809902 |
T |
 |
| Q |
211 |
tgatagtaacaggacctaagaa |
232 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
10809901 |
tgatagtaacaggacctaagaa |
10809880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University