View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19381_low_48 (Length: 202)
Name: NF19381_low_48
Description: NF19381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19381_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 8 - 179
Target Start/End: Complemental strand, 836547 - 836376
Alignment:
| Q |
8 |
atgtcgaagaatatagtgcggtattttctaaagtagtaaagatcctgtgcaatattgcacgattgcgaaaaaacaaagtgacataaaatagtaaatatca |
107 |
Q |
| |
|
||||| || ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
836547 |
atgtctaaaaatatagtgcggtatttactaaagtagtaaagatcatgtgcaatattgcacgattgcgaaaaaacaaagtgacataaaatagtaaatatca |
836448 |
T |
 |
| Q |
108 |
cgtacaattctgttaaacttaatgtctttctgtgcgttcgaattcgctgtccttcgattttctaaagttact |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
836447 |
cgtacaattctgttaaacttaatgtctttctgtgcgttcgaattcgctgtccttcaattttctaaagttact |
836376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University