View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19382_high_36 (Length: 402)
Name: NF19382_high_36
Description: NF19382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19382_high_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 1e-41; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 288 - 386
Target Start/End: Original strand, 31016712 - 31016810
Alignment:
| Q |
288 |
tcagatgaagaagcagcaaatggaatttcaaacacattgtaggaagattacaaatttagcatccgatttgcctattgattccaaccattgttgactagt |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31016712 |
tcagatgaagaagcagcaaatggaatttcaaacacattgtaggcagattacaaattgagcatccgatttgcctattgtttccaaccattgttgactagt |
31016810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 31016266 - 31016323
Alignment:
| Q |
103 |
tttccgcgttattaattaacttcatagatttgtaatgataatgtgtaattagatatta |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31016266 |
tttccgcgttattaattaacttcatagatttgtaatgataatgtgtaattagatatta |
31016323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 31016231 - 31016268
Alignment:
| Q |
1 |
aagtataagacaaaacaattcagtaattaatattattt |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31016231 |
aagtataagacaaaacaattcagtaattaatattattt |
31016268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 333 - 382
Target Start/End: Original strand, 31026765 - 31026813
Alignment:
| Q |
333 |
gattacaaatttagcatccgatttgcctattgattccaaccattgttgac |
382 |
Q |
| |
|
|||| |||||| || |||||||| |||||||||||||||||||||||||| |
|
|
| T |
31026765 |
gattccaaattgaggatccgatt-gcctattgattccaaccattgttgac |
31026813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University