View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19382_high_83 (Length: 243)
Name: NF19382_high_83
Description: NF19382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19382_high_83 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 15 - 227
Target Start/End: Complemental strand, 3784004 - 3783792
Alignment:
| Q |
15 |
agcataggaaaattaaagtgattttgtgaatgagtttgtcgctatgtatgtctatgttgtgcgcattttatgtctttggtttgtcttttgttttctttaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3784004 |
agcataggaaaattaaagtgattttgtgaatgagtttgtcgctatgtatgtctatgttgtgcgcattttatgtctttggtttgtcttttgttttctttaa |
3783905 |
T |
|
| Q |
115 |
gaaggaagacaataaggagaggggatactattggaagtggagacaggtaaagaacatagtggtcagacagctcaccatgcagtaaccagtacgcaccaag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3783904 |
gaaggaagacaataaggagaggggatactattggaagtggagacaggtaaagaacatagtggtcagacagctcaccatgcagtaaccagtacgcaccaag |
3783805 |
T |
|
| Q |
215 |
cacgcttgatact |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3783804 |
cacgcttgatact |
3783792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University