View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19382_low_105 (Length: 209)
Name: NF19382_low_105
Description: NF19382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19382_low_105 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 46 - 191
Target Start/End: Complemental strand, 52880106 - 52879959
Alignment:
| Q |
46 |
ttataatatcaaaattttgtgttcagatatcaactttgtttaaatttctccnnnnnnnnnn--ggtatgcatatatttcattatatttttcgctgttatt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52880106 |
ttataatatcaaaattttgtgttcagatatcaactttgtttgaatttctccaaaaaaaaaaaaggtatacatatatttcattatatttttcgctgttatt |
52880007 |
T |
|
| Q |
144 |
ttctccaacctttagatatatacggttgtgtttatccttatctaatct |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52880006 |
ttctccaacctttagatatatacggttgtgtttctccttatctaatct |
52879959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 52880180 - 52880139
Alignment:
| Q |
7 |
ggttcctaaccaataccccctttaattattactatttactta |
48 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
52880180 |
ggttcctagccaataccccctttaattattactatctactta |
52880139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University