View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19382_low_109 (Length: 202)
Name: NF19382_low_109
Description: NF19382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19382_low_109 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 12 - 169
Target Start/End: Complemental strand, 22636681 - 22636524
Alignment:
| Q |
12 |
cacagaagcagttataaatcaagcaacacaaacagggttagcaccgaatacctcagatgctcataccatcaatggccttccaggtcctctccacaactgt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22636681 |
cacagaagcagttataaatcaagcaacacaaacagggttagcacctaatacctcagatgctcacaccatcaatggtcttccaggtcctctccacaactgt |
22636582 |
T |
 |
| Q |
112 |
gtagctaaaggtatgtagtaccaacaaattagattaaaagtgtgtccagtatcggaca |
169 |
Q |
| |
|
||||||||||| |||||||| | |||| ||||||||||||||||||||||| |||| |
|
|
| T |
22636581 |
tcagctaaaggtaagtagtaccgaaaaatcagattaaaagtgtgtccagtatccgaca |
22636524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University