View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19382_low_18 (Length: 509)
Name: NF19382_low_18
Description: NF19382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19382_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-116
Query Start/End: Original strand, 273 - 501
Target Start/End: Original strand, 11334280 - 11334508
Alignment:
| Q |
273 |
gtgaaagagtactactgttcttgttgcacatcactcacttacacatacacacactgttacctaacaaaactacaaaactagtttctttcaagtttcaagc |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11334280 |
gtgaaagagtactactgttcttgttgcacatcactcacttacacatacacacactgttagctaacaaaactacaaaactagtttctttcaagtttcaagc |
11334379 |
T |
|
| Q |
373 |
acagttaccaaattagcttttatgatgagaaaatggaagagagtagaataatggagtggggagagaaaagtgaacaaaaagggtgtgacttttgttgaga |
472 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11334380 |
acagttaccaaactagcttttatgatgagaaaatggaagagagtataataatggagtggggagagaaaagtgagcaaaaagggtgtgacttttgttgaga |
11334479 |
T |
|
| Q |
473 |
gaggacactgacctaagagatgatgatgt |
501 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11334480 |
gaggacactgacctaagagatgatgatgt |
11334508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 146 - 205
Target Start/End: Original strand, 11334153 - 11334212
Alignment:
| Q |
146 |
ctacgtgattttagtgaagaagaagaggaagatgaagaaggtgaaattgatgaacatata |
205 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11334153 |
ctacgtgattttagtgaagaggaagaggaagatgaagaaggtgaaattgatgaacatata |
11334212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University