View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19382_low_22 (Length: 478)
Name: NF19382_low_22
Description: NF19382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19382_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 111 - 472
Target Start/End: Complemental strand, 49862370 - 49862018
Alignment:
| Q |
111 |
gtcatcaatcaactcactgagtctcctccctttcacctcattctgcatctgcggcacaatccaacgacggagaaatgcttggtttcctctctctgctaag |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49862370 |
gtcatcaatcaactcaccgagtctcctccctttcacctcgttctgca---------caatccaacgacggagaaatgcttggtttcctctctctgctaag |
49862280 |
T |
 |
| Q |
211 |
gattctcgtgaacgacaaaacacgactcattggtgaccgaaacgatgatggtgaatcacaactcgactctcccacagcaaaactcttgcaatcggattca |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49862279 |
gattctcgtgaacgacaaaacacgactcattggtgaccgaaacgatgatggtgaatcacaactcgactctcccacagcaaaactcttgcaatcggattca |
49862180 |
T |
 |
| Q |
311 |
ctccttctcggaatctcaacggtaatgtcaaccaatgaagattgcttctcatcagaacatgaggaagaacaagaagaagaaaattccgatacagactggt |
410 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
49862179 |
ctccttctcggaatctcaacggtaatgtcaaccgatgaagattgcttctcatcagaacatgaggaagaacaagaagaagaaaattccgatacagaccggt |
49862080 |
T |
 |
| Q |
411 |
tcatttcatcaccagaactcgaacccaaaaccaattccggttcacacatatcaattgtcact |
472 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49862079 |
tcatttcttcaccagaactcgaacccaaaaccaattccggttcacacatatcaattgtcact |
49862018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 6 - 75
Target Start/End: Complemental strand, 49862440 - 49862371
Alignment:
| Q |
6 |
catggcaaatgatgatggtaatccctcgccgttcactttataatttgtgttgcgacattcatgcacttaa |
75 |
Q |
| |
|
|||||||||||||||| || ||||||| ||||| || || ||||||||||||| |||||||||||||||| |
|
|
| T |
49862440 |
catggcaaatgatgatcgtcatccctccccgttgacattgtaatttgtgttgcaacattcatgcacttaa |
49862371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University