View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19382_low_28 (Length: 451)
Name: NF19382_low_28
Description: NF19382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19382_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 21072908 - 21073180
Alignment:
| Q |
1 |
atctcaacaagtgtaatttctttgattaatcaggttagaaaaaacttctatctttcnnnnnnnnnn----tcattatataaataaatatgtatttatttt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
21072908 |
atctcaacaagtgtaatttctttgattaatcaggttagaaaaaacttctatctttcaaaaaaaaaaaaaatcattatataaataaatatgtattgatttt |
21073007 |
T |
|
| Q |
97 |
tgtgtcatatgctggaatcaatatttaattgtctttcatgcttctgttaataaagctaagaacatatatgggatgcaggtttccaagactaaaacgacag |
196 |
Q |
| |
|
|||||||||||||||| ||||||||| || ||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
21073008 |
tgtgtcatatgctggactcaatattttatggtctttcatgcttctattaataaagctaagaacatatatgggatgcagatttccaagactaaaacgagag |
21073107 |
T |
|
| Q |
197 |
gtagattactgccttgctcaaagtgacatgtaaatatccatttcatgaagagcgagacattatgcaggttagc |
269 |
Q |
| |
|
| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21073108 |
gcatattactgccttgctcaaagtgacatgtaaatatccatttcatgaagagcgagacattatgcaggttagc |
21073180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 331 - 433
Target Start/End: Original strand, 21073242 - 21073344
Alignment:
| Q |
331 |
caatttgtttgcagaaatgatttggtgatttgcattgataattacaccactttagggatgatgtcgtgataaatgtagttataatttctattttgttgca |
430 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21073242 |
caatttgtttgcagaaataatttggtgatttgcattgataatcacaccactttagggatgatgtcgtgataaatgtagttataatttctattttgttgca |
21073341 |
T |
|
| Q |
431 |
gaa |
433 |
Q |
| |
|
||| |
|
|
| T |
21073342 |
gaa |
21073344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University