View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19382_low_62 (Length: 302)
Name: NF19382_low_62
Description: NF19382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19382_low_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 36 - 288
Target Start/End: Original strand, 34446599 - 34446851
Alignment:
| Q |
36 |
tactagagtcttaattgtgtactctacacaactagaaagactttcataaaactttagaaaatgacagggtttggctcatcatgtggagcatgcaagttcc |
135 |
Q |
| |
|
||||| |||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34446599 |
tactatagtcttaattgtgtgctatacacaactagaaagactttcataaaactttagaaaatgacagggtttggctcatcatgtggagcatgcaagttcc |
34446698 |
T |
|
| Q |
136 |
taaggagaaagtgtgctagtgattgtgtttttgctccatacttctcctatgaacaggcttcaactcatttttcagcagtgcataaggtttatggagctag |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34446699 |
taaggagaaagtgtgctagtgattgtgtttttgctccatacttctcctatgaacaagcttcaagtcatttttcagcagtgcataaggtttatggggctag |
34446798 |
T |
|
| Q |
236 |
taatgtctctagactattgtcacatcttcctattcaaaatagaagtgatgctg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34446799 |
taatgtctctagactattgtcacatcttcctattcaaaatagaagtgatgctg |
34446851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University