View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19382_low_64 (Length: 300)
Name: NF19382_low_64
Description: NF19382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19382_low_64 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 7 - 194
Target Start/End: Complemental strand, 15502671 - 15502482
Alignment:
| Q |
7 |
agatcatttataaaattattggtatctcttatttaagacattttagtatggtgtggggttgaaaaaattgagttttgttaagtgatactatttaaaaatt |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15502671 |
agatcatttataaaattattggtgtctcttatttaagacattttagtatggtgtggggttgaaaaaattgagttttattaagtgatactatttaaaaatt |
15502572 |
T |
|
| Q |
107 |
attaatgagtggtgtgtgcaggtaagatctatttaaatatcaaataat--ggatctcttttaaggatgacaaaaatatttgtacctgtgg |
194 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||| | |||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
15502571 |
attaatgagtggtgtgtgcaggtaacatctatttaaatattaaataatgagtctctcttttaaggatgacaaaaacatttgtatctgtgg |
15502482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University