View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19382_low_77 (Length: 257)
Name: NF19382_low_77
Description: NF19382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19382_low_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 239
Target Start/End: Complemental strand, 23703045 - 23702815
Alignment:
| Q |
9 |
gataatacttgtaattcatcatataaaatacgaaacaggaacttgccttgatgccaatacatcggttcacatcaaggaccgtaatgttgttggaacagaa |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
23703045 |
gataacacttgtaattcatcatataaaatacgaaacaggaacttgccttgatgccaatacatcggttcacatcaaggaccgtaatgttgttggaacataa |
23702946 |
T |
|
| Q |
109 |
ctttgaaagtgcttctaggcatttatcagccacaccaactattgaggtaatgtcacgctgccattgtaaaaagaatatgcatatgtatgcgtataataat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23702945 |
ctttgaaagtgcttctaggcatttatcagccacaccaactattgaggtaatgtcacgctgccattgtaaaaagaatatgcatatgtatgcgtataataat |
23702846 |
T |
|
| Q |
209 |
gcattacttcatcgtgttgtgataacccttt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23702845 |
gcattacttcatcgtgttgtgataacccttt |
23702815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 40 - 84
Target Start/End: Original strand, 23744489 - 23744533
Alignment:
| Q |
40 |
gaaacaggaacttgccttgatgccaatacatcggttcacatcaag |
84 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
23744489 |
gaaataggaatttgccttgatgccaatacatccgttcacatcaag |
23744533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University