View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19382_low_80 (Length: 254)
Name: NF19382_low_80
Description: NF19382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19382_low_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 238
Target Start/End: Original strand, 42621293 - 42621519
Alignment:
| Q |
20 |
acattgtacttgcaacttagccttactaagtactctataaacca--------atgtaggtttttcgcataatggcaaaaatcctcaaggcaaacgacttg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42621293 |
acattgtacttgcaacttagccttactaagtactctataaaccaatgtaccaatgtaggtttttcgcataatggcaaaaatcctcaaggcaaacgacttg |
42621392 |
T |
 |
| Q |
112 |
cttgcgcagaaataaatatgagcttcagatgttaatagtactttatttcatgtacaataaactgaaaattgacatgataaaaaatgtggattcaactatt |
211 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42621393 |
cttgcacagaaataaatatcagcttcagatgttaatagtactttatttcatgtacaataaactgaaaattgacatgataaaaaatgtggattcaactgtt |
42621492 |
T |
 |
| Q |
212 |
attatgaagtgaatgaagatagtgaat |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42621493 |
attatgaagtgaatgaagatagtgaat |
42621519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University