View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19382_low_83 (Length: 252)
Name: NF19382_low_83
Description: NF19382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19382_low_83 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 41826026 - 41825803
Alignment:
| Q |
19 |
ctttgtaacatcacctaaccacaaaatttacaaacaaatttcttctctcaagtagaagaatgttgttgctgctgcagctgctgagtgttctgaaattcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41826026 |
ctttgtaacatcacctaaccacaaaatttacaaacaaatttcttctctcaagtagaagaatgttgttgctgctgcagctgctgagtgttctgcaattcaa |
41825927 |
T |
|
| Q |
119 |
gctccttttgacgtagcaacaaaaccattctatcaatttccaaactcttcctttcattttcaagtttttgtctctccatttccctttctttgttactact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41825926 |
gctccttttgacgtagcaacaaaaccattctatcaatttccaaactcttcctttcattttcaagtttttgtctctccatttccctttctttgttactact |
41825827 |
T |
|
| Q |
219 |
aaatttcacccatttcaacctttg |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41825826 |
aaatttcacccatttcaacctttg |
41825803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 138 - 245
Target Start/End: Original strand, 26919314 - 26919421
Alignment:
| Q |
138 |
caaaaccattctatcaatttccaaactcttcctttcattttcaagtttttgtctctccatttccctttctttgttactactaaatttcacccatttcaac |
237 |
Q |
| |
|
|||||||||||| ||| |||| || || |||||||||| |||||||| ||||||||||||||| ||||| ||||||||| | | ||||||||||| |
|
|
| T |
26919314 |
caaaaccattctctcattttctaatcttctcctttcattctcaagtttagctctctccatttccctctctttcttactactataccttgcccatttcaac |
26919413 |
T |
|
| Q |
238 |
ctttgctt |
245 |
Q |
| |
|
|||||||| |
|
|
| T |
26919414 |
ctttgctt |
26919421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University