View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19382_low_84 (Length: 250)
Name: NF19382_low_84
Description: NF19382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19382_low_84 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 85 - 250
Target Start/End: Original strand, 52035632 - 52035797
Alignment:
| Q |
85 |
tttttaaaaaagtgtcattttttagagaatgaaataaataaagtagctaaaatttaatacacactcattgcatcgttttgtcaatattgtgatcaaaagc |
184 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035632 |
tttttacaaaagtgtcattttttagagaatgaaataaataaagtagctaaaatttaatacacactcattgcatcgttttgtcaatattgtgatcaaaagc |
52035731 |
T |
|
| Q |
185 |
atctcatgtcatttttaactcgactcaacttgccgtatgagctatgatatacattgtcgggagaga |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52035732 |
atctcatgtcatttttaactcgactcaacttgccgtatgagcgatgatatacattgtcgggagaga |
52035797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 55
Target Start/End: Original strand, 52035594 - 52035641
Alignment:
| Q |
8 |
cgaataatatgctttttctttcacaatctttcattcaatttttacaaa |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035594 |
cgaataatatgctttttctttcacaatctttcattcaatttttacaaa |
52035641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University