View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19382_low_86 (Length: 243)
Name: NF19382_low_86
Description: NF19382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19382_low_86 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 8047259 - 8047484
Alignment:
| Q |
1 |
taagttatcttggcaaagagattttccgttctttaaattaactttaagagtctatgtcttgattttcatgaatgattgaggtgtaggnnnnnnntctgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8047259 |
taagttatcttggcaaagagattttccgttctttaaattaactttaagagtctatgtcttgattttcatgaatgattgaggtgtaggaaaaaagtctgat |
8047358 |
T |
 |
| Q |
101 |
tataccccttggaattttgaagggaaagattggagtgaattttttattacatggtttgtgaattgtgatgaattggttgtaggggaaatcatattggcga |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8047359 |
tataccccttagaattttgaagggaaagattggagtgaattttttaatacatggtttgtgaattgtgatgaattggttgtaggggaaatcatattggcga |
8047458 |
T |
 |
| Q |
201 |
gcaaataattgatgggaagggaatct |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
8047459 |
gcaaataattgatgggaagggaatct |
8047484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University