View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19382_low_88 (Length: 242)
Name: NF19382_low_88
Description: NF19382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19382_low_88 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 134 - 227
Target Start/End: Original strand, 4090484 - 4090577
Alignment:
| Q |
134 |
atggaatgaacagaagatcactaggaaccttggatcaagcttctttgactttttatggtataccatcaaggacaatcgttgcacagtttcattg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4090484 |
atggaatgaacagaagatcactaggaaccttggatcaagcttctttgactttttatggtataccatcaaggacaatcgttgcacagtttcattg |
4090577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 4 - 100
Target Start/End: Original strand, 4090354 - 4090450
Alignment:
| Q |
4 |
gatggacatcatcattagctgtaggcactccgcaagatttcccaacataatatacactactactagcagttgttataattagcttgagaaagatgta |
100 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4090354 |
gatggacctgatcattagctgtaggcactccgcaagatttcccaacataatatacactactactagcagttgttataattagcttgagaaagatgta |
4090450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University