View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19383_high_14 (Length: 250)
Name: NF19383_high_14
Description: NF19383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19383_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 65 - 216
Target Start/End: Original strand, 4057176 - 4057329
Alignment:
| Q |
65 |
aatgtgtatatccttaggtcaccaaaaaccgccatgattcgctaat-aaattgataatctctcttagtgatt-aaaaaagttcaaagttttgaattgttt |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4057176 |
aatgtgtatatccttaggtcaccaaaaaccgccatgattcgctaaacaaattgataatctctcttagtgatttaaaaaagttcaaagttttgaattgttt |
4057275 |
T |
|
| Q |
163 |
ctctgagtcattttgttgctttcttagcaaatttatctgccctctattgcttct |
216 |
Q |
| |
|
|||| ||||||||| |||||| |||||||||||||||| |||||| || ||||| |
|
|
| T |
4057276 |
ctctaagtcattttattgcttgcttagcaaatttatcttccctcttttacttct |
4057329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University