View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19383_high_25 (Length: 214)
Name: NF19383_high_25
Description: NF19383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19383_high_25 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 142 - 214
Target Start/End: Complemental strand, 49157070 - 49156998
Alignment:
| Q |
142 |
gaccgttgtgttatttgtcacaaaactagccacaacaattggttggtgtgtgatatgaatgaagcataatttt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49157070 |
gaccgttgtgttatttgtcacaaaactagccacaacaattggttggtgtgtgatatgaatgaagcataatttt |
49156998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 49157211 - 49157148
Alignment:
| Q |
1 |
gattgctaaggaaaatgcggcttaattaatcacatttcacacaaatttgagcttctcttaatcc |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49157211 |
gattgctaaggaaaatgcggcttaattaatcacatttcacacaaatttgagcttctcttaatcc |
49157148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University