View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19383_high_25 (Length: 214)

Name: NF19383_high_25
Description: NF19383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19383_high_25
NF19383_high_25
[»] chr1 (2 HSPs)
chr1 (142-214)||(49156998-49157070)
chr1 (1-64)||(49157148-49157211)


Alignment Details
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 142 - 214
Target Start/End: Complemental strand, 49157070 - 49156998
Alignment:
142 gaccgttgtgttatttgtcacaaaactagccacaacaattggttggtgtgtgatatgaatgaagcataatttt 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49157070 gaccgttgtgttatttgtcacaaaactagccacaacaattggttggtgtgtgatatgaatgaagcataatttt 49156998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 49157211 - 49157148
Alignment:
1 gattgctaaggaaaatgcggcttaattaatcacatttcacacaaatttgagcttctcttaatcc 64  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49157211 gattgctaaggaaaatgcggcttaattaatcacatttcacacaaatttgagcttctcttaatcc 49157148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University