View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19383_low_13 (Length: 300)
Name: NF19383_low_13
Description: NF19383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19383_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 42056396 - 42056511
Alignment:
| Q |
1 |
ctcgcatcactacaaatgatgacatacttagtagtcttctctgatatggttagagatgctccactcatcaaacccatatttatagaaaagacattcctgt |
100 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42056396 |
ctcgcatcactacaaatgatgacctaattagtagtcttctctgatatgcttagagatgctccactcatcaaacccatatttatagaaaagacattcctgt |
42056495 |
T |
|
| Q |
101 |
gcattcccctactcca |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42056496 |
gcattcccctactcca |
42056511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 184 - 288
Target Start/End: Original strand, 42056579 - 42056683
Alignment:
| Q |
184 |
gagggatgaagagggggatagatgtgatgtagtggaattctccaaagggtcaagatacatctctcacctattagacattacttcttaaatcttcaccgag |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42056579 |
gagggatgaagagggggatagatgtgatgtagtggaattctccaaagggtcaagatacatctctcacctattagactttacttcttaaatcttcaccgag |
42056678 |
T |
|
| Q |
284 |
atatt |
288 |
Q |
| |
|
||||| |
|
|
| T |
42056679 |
atatt |
42056683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University