View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19383_low_18 (Length: 240)
Name: NF19383_low_18
Description: NF19383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19383_low_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 240
Target Start/End: Original strand, 2136120 - 2136340
Alignment:
| Q |
20 |
ataggttctattttgccatagtgaagctatgcaatcacttctctcaagaatgagacttggtactccttgttctgataaacaagcagctactgctatacct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2136120 |
ataggttctattttgccatagtgaagctatgcaatcacttctctcaagaatgagacttggtactccttgctctgataaacaagcagctactgctatacct |
2136219 |
T |
 |
| Q |
120 |
gaaggaccagcacctactatgataggtccatgaatccatacacactttactttttctttgaaaggatccatgtaagagaacttgagaactagtagagttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2136220 |
gaaggaccagcacctactatgataggtccatgaatccatacacactttactttttctttgaaaggatccatgtaagagaacttgagaactagtagagttt |
2136319 |
T |
 |
| Q |
220 |
agtgtagtgtactagtttttt |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2136320 |
agtgtagtgtactagtttttt |
2136340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University