View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19383_low_22 (Length: 235)
Name: NF19383_low_22
Description: NF19383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19383_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 16 - 229
Target Start/End: Complemental strand, 47558342 - 47558127
Alignment:
| Q |
16 |
atttgtgcggtccattctatttgacaagagtcggtagttttttgttttgtaaaccaaatttatactagtaaagaccgtgtctaagattagacagataagg |
115 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47558342 |
atttgtgcggtctattctatttgacaagagtcggtagttttttgttttgtaaaccaaatttatactagtaaagaccgtgtctaagattagacagataagg |
47558243 |
T |
 |
| Q |
116 |
-nnnnnnnnnctgggggaaat-aatgtgtgaaactgtgttttgtaagtgaaagactttccttttcttatgatagatagcagtaacggatcgtccttaaaa |
213 |
Q |
| |
|
||| ||||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
47558242 |
aaaaaaaaaactgtgggaaataaatgtgtgaaactgtgtttcgtaagtgaaagattttccttttcttatgatagatagcagtagcggatcgtccttagaa |
47558143 |
T |
 |
| Q |
214 |
ctgggggtgcatgcca |
229 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
47558142 |
ctgggggtgcatgcca |
47558127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University