View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19384_low_3 (Length: 205)
Name: NF19384_low_3
Description: NF19384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19384_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 20 - 185
Target Start/End: Original strand, 15596949 - 15597114
Alignment:
| Q |
20 |
aatacggacagtccaaattcggtgttcttgaaatatagaaaagggatgtcgtcatgcaagttagaaatcttcgtgatctatgttatgtggttatgtatgt |
119 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||||||| | ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15596949 |
aatacggacagtccaacctcggtgttcttgaaatatagaaaagcgatgtcgtgacgcaagttagaaatcttcgtgacctatgttatgtggttatgtatgt |
15597048 |
T |
 |
| Q |
120 |
ttaagcaatatgcgagataagaggaagatgagattattagtttctttatactaacagttgggagat |
185 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15597049 |
ttaagctatatgcgagataagaggaagatgagattattagtttctttatactaacagttgggagat |
15597114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University