View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19385_low_10 (Length: 301)
Name: NF19385_low_10
Description: NF19385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19385_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 17 - 172
Target Start/End: Original strand, 36920695 - 36920850
Alignment:
| Q |
17 |
gaaacaaattacgtggtccaggaatttgttcttctatctttaagctataagaaacaaactcaatatagg--gaatatgtctcaatcacaagtacaccaaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36920695 |
gaaacaaattacgtggtccaggaattttttcttctatctttaagcta--agaaacaaactcaatataggaggaatatgtctcaatcacaagtacaccaaa |
36920792 |
T |
|
| Q |
115 |
aacagaagatttaaaacaaaacattggttgttgcagttgcttattatttcagcataaa |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36920793 |
aacagaagatttaaaacaaaacattggttgttgcagttgcttattatttcagcataaa |
36920850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 227 - 286
Target Start/End: Original strand, 36920944 - 36921003
Alignment:
| Q |
227 |
aattaataagtgtgaaagttagtattaattgtgtccggatagagaatatattgtgtgttg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36920944 |
aattaataagtgtgaaagttagtattaattgtgtccggatagagaatatattgtgtgttg |
36921003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 197 - 231
Target Start/End: Original strand, 36920876 - 36920910
Alignment:
| Q |
197 |
ggtgtttagatttctttaaagtttaaactcaatta |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36920876 |
ggtgtttagatttctttaaagtttaaactcaatta |
36920910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University