View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19385_low_14 (Length: 250)
Name: NF19385_low_14
Description: NF19385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19385_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 46444928 - 46445161
Alignment:
| Q |
1 |
caacttcaagcgcaggagcagaaacttattctagaaaggcttgttgatgtcgttgataatgatcctcagagattcttccaccgtatgagaagccgattcg |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46444928 |
caacttcaatcgcaggagcagaaacttattctagaaaggcttgttgatgtcgttgataatgatcctgagagattcttccaccgtatgagaagccgattcg |
46445027 |
T |
|
| Q |
101 |
acgcgtaattataccttttccttcatcattccttttttattttcgcaaaatgtagagtactacaacacacgattttcaagcaatcgcgttaattatgtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46445028 |
acgcgtaattataccttttccttcatcattcc-tttttattttcgcaatatgtagagtactacaacacacgattttcaagcaatcgcgttaattatgtgt |
46445126 |
T |
|
| Q |
201 |
ttatcaaattggaaatggcgctacttgtgcttcat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
46445127 |
ttatcaaattggaaatggcgctacttgtgcttcat |
46445161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University