View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19386_high_3 (Length: 258)
Name: NF19386_high_3
Description: NF19386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19386_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 16 - 116
Target Start/End: Complemental strand, 29696148 - 29696048
Alignment:
| Q |
16 |
atgagtcttaattggtgttcctcttgattgagagcaatctgaagaaacaacttatccgtaagctctcatgtgataagtgttaattgaagaacttagttaa |
115 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29696148 |
atgagtcttaactggtgttcctctttattgagagcaatttgaagaaacaacttatccataagctctcatgtgataagtgttaattgaagaacttaattaa |
29696049 |
T |
 |
| Q |
116 |
g |
116 |
Q |
| |
|
| |
|
|
| T |
29696048 |
g |
29696048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 105 - 258
Target Start/End: Complemental strand, 29695593 - 29695437
Alignment:
| Q |
105 |
aacttagttaagtgcctatcatataagttcttttcat-agcgatcgtggagagcttatacaaacaagttgaaaccaacttgtgaaaaagccatgacttaa |
203 |
Q |
| |
|
|||||| ||||| ||||||| ||| ||| ||||||| ||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
29695593 |
aacttaattaagcgcctatctaatatgttgttttcattagctatcgtggagagcttatacaaataagttgaaaccaacttgtgaaaaagtcataacttaa |
29695494 |
T |
 |
| Q |
204 |
gt--tttttctattttctctcaaagagtctcccatgtgtttatgtcaaatgataaac |
258 |
Q |
| |
|
| ||||| | | |||| ||||| ||||| || ||||||||| |||||||||||| |
|
|
| T |
29695493 |
attgtttttatgtgttctttcaaatggtctcacaagtgtttatgccaaatgataaac |
29695437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University