View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19387_low_3 (Length: 251)
Name: NF19387_low_3
Description: NF19387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19387_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 3 - 238
Target Start/End: Original strand, 6316622 - 6316859
Alignment:
| Q |
3 |
atcagactttataaataggaaactaaagatcaatgcaaatagagaaaaataaccatattcactgccgaaaactatatcataacctcagtctgcatcatat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6316622 |
atcagactttataaataggaaactaaagatcaatgcaaatagagaaaaataaccatattcactgccgaaaactatatcataacctcagtctgcatcatat |
6316721 |
T |
 |
| Q |
103 |
tgaaaccatattaaccccagacacgtatcgg--ttgtattgtgtcctggtctattttaatctaaaacatgaaagtagtaacggaattatataagtaagtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6316722 |
tgaaaccatattaaccccagacacgtatcggtattgtattgtgtcttggtctattttaatctaaaacatgaaagtagtaacggaattatataagtaagtg |
6316821 |
T |
 |
| Q |
201 |
aaaaagaagttttggttcttagtgtagtcagttcaaaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6316822 |
aaaaagaagttttggttcttagtgtagtcagttcaaaa |
6316859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University