View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19388_low_14 (Length: 233)
Name: NF19388_low_14
Description: NF19388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19388_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 9 - 219
Target Start/End: Original strand, 14963138 - 14963347
Alignment:
| Q |
9 |
aatattgagtaaaatattttttaaaaggaaaataaatgctggataatttctaagataatttcatcaagtatcagatgcttatcgttgtgagatatcgata |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14963138 |
aatattgagtaaaatattttttaaaaggaaaataaatgctagataatt-ctaagataatttcatcaagtatcagatgcttatcgttgtgagatatcgata |
14963236 |
T |
 |
| Q |
109 |
cttttattcattattgaagtacataaacttcttagcatatatcacaatgaaagtgtcatttgcttgagtatatcatagcttgaagcataattaattattc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14963237 |
cttttattcattattgaagtacataaacttcttagcatatatcacaatgaaagtgtcatttgcttgagtatatcatagcttgaagcataattaattattc |
14963336 |
T |
 |
| Q |
209 |
cttgtcacata |
219 |
Q |
| |
|
||||||||||| |
|
|
| T |
14963337 |
cttgtcacata |
14963347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University