View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1938_high_13 (Length: 249)
Name: NF1938_high_13
Description: NF1938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1938_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 67 - 237
Target Start/End: Original strand, 5891547 - 5891717
Alignment:
| Q |
67 |
gaaggatgagaagttggaactaaatttagaaaagaaagagtcaatcaagggtgcatgtacagttagtggagcctacctttgtcacattaacaaaacaaaa |
166 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5891547 |
gaaggatgaaaagttggaactaaatttagaaaagaaagagtcaatcaaggttgcatgtacagttagtggagcctaccttggtcacattaacaaaacaaaa |
5891646 |
T |
 |
| Q |
167 |
atgcttgctcttacctcattccacatcttttgttgtaaaaaacactggctgcaatgtgaaaagtcaaacct |
237 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
5891647 |
atgtttgctcttacctcattccacatcttttgttgtaaaaaacactggcttttacatgaaaagtcaaacct |
5891717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University