View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1938_high_7 (Length: 329)

Name: NF1938_high_7

Description: NF1938

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1938_high_7

[»] chr8 (2 HSPs)

Target: chr8 (Bit Score: 161; Significance: 8e-86; HSPs: 2)

Name: chr8

Description:

Target: chr8; HSP #1

Raw Score: 161; E-Value: 8e-86

Query Start/End: Original strand, 160 - 320

Target Start/End: Original strand, 31606901 - 31607061

Alignment:

Q	160	attaaacttctgattaatgttgatgaatggcaggttggtccaagaacttcaaatgatagacaaaattttccaccaaataacataattcacatgcttggag	259	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	31606901	attaaacttctgattaatgttgatgaatggcaggttggtccaagaacttcaaatgatagacaaaattttccaccaaataacataattcacatgcttggag	31607000	T

Q	260	gtgcagggttcttatggatgggttggacaggttttaacggaggagcgccttttcaagtggg	320	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	31607001	gtgcagggttcttatggatgggttggacaggttttaacggaggagcgccttttcaagtggg	31607061	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2

Raw Score: 47; E-Value: 8e-18

Query Start/End: Original strand, 11 - 65

Target Start/End: Original strand, 31606813 - 31606867

Alignment:

Q	11	ttatactaaaattatggtttatttcaaaactttacaaattcaagtaaaattttgc	65	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	31606813	ttatactaaaattatggtttatttcaaaactttacaagctcaagtaaaattttgc	31606867	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]