View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1938_high_9 (Length: 319)
Name: NF1938_high_9
Description: NF1938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1938_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 301
Target Start/End: Original strand, 31607097 - 31607379
Alignment:
| Q |
19 |
tgtgcactgctacaagcatacttgtttggatttctctagatatggctgtatacaagaagggctcattgataggttctgtccaaggaatgatgactggtct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31607097 |
tgtgcactgctacaagcatacttgtttggatttctctagatatggctgtatacaagaaaggctcattgataggttctgtccaaggaatgatgactggtct |
31607196 |
T |
|
| Q |
119 |
cgtttgcattactccgggtgcaggtaaagctcacacaaaacgacacattcaatagttgcgagatataattctgaaaacttctttctaagcttacatgtcc |
218 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31607197 |
cgtttgcatcacaccgggtgcaggtaaagctcacacaaaacgacacattcagtagttgcgagatataattctgaaaacttctttctaagcttacatgtcc |
31607296 |
T |
|
| Q |
219 |
acaagtaatgacattatttttacctatgtatgtgaccaggattggtggatccttgggcagcaatattgatgggagctttgtcc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31607297 |
acaagtaatgacattatttttacctatgtatgtgacaaggattggtggatccatgggcagcaatattgatgggagctttgtcc |
31607379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University