View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1938_low_14 (Length: 247)
Name: NF1938_low_14
Description: NF1938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1938_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 33300396 - 33300559
Alignment:
| Q |
1 |
cgaaaattataacttctactatttatgtgaaaaatatatcttctatttatgttgtttatcttaatagtatcttaacataaca-caacatcttctgtatct |
99 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33300396 |
cgaaaactataccttctactatttatgtgaaaaatatatcttctatttatgttgtttattttaatagtatcttaacataacaacaacatcttctgtatct |
33300495 |
T |
 |
| Q |
100 |
atcataaactcgtgtggtaacttagatatatgccaagtatctataaagtttatgatattcaaaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33300496 |
atcataaactcgtgtggtaacttagatatatgccaagtatctataaagtttatgatattcaaaa |
33300559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University