View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1938_low_15 (Length: 235)

Name: NF1938_low_15
Description: NF1938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1938_low_15
NF1938_low_15
[»] chr2 (1 HSPs)
chr2 (15-209)||(33299682-33299882)


Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 15 - 209
Target Start/End: Original strand, 33299682 - 33299882
Alignment:
15 gaaacatcaaatcaaacagttac--tggattgttctacaaattttgaattctctaaaatttcttttatagcatacaaaatgtgttatagtagcatagtga 112  Q
    |||||||||||||||||||||||  |||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||    
33299682 gaaacatcaaatcaaacagttacagtggactgttctacaaattttgaattctctaaattttctttaatagcatacaaaatgtgttatagtagcatagtga 33299781  T
113 gtgataacatgtaccttcagattttgctcttataaattagaggatgaagatcgttctgagt----ttaaaggaaactacatatgatccacatgatcagat 208  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||    |||||||||||||||||| ||||||||| ||||||    
33299782 gtgataacatgtaccctcagattttgctcttataaattagaggatgaagatcattctgagtttaattaaaggaaactacatattatccacatgttcagat 33299881  T
209 g 209  Q
    |    
33299882 g 33299882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University