View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1938_low_15 (Length: 235)
Name: NF1938_low_15
Description: NF1938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1938_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 15 - 209
Target Start/End: Original strand, 33299682 - 33299882
Alignment:
| Q |
15 |
gaaacatcaaatcaaacagttac--tggattgttctacaaattttgaattctctaaaatttcttttatagcatacaaaatgtgttatagtagcatagtga |
112 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33299682 |
gaaacatcaaatcaaacagttacagtggactgttctacaaattttgaattctctaaattttctttaatagcatacaaaatgtgttatagtagcatagtga |
33299781 |
T |
|
| Q |
113 |
gtgataacatgtaccttcagattttgctcttataaattagaggatgaagatcgttctgagt----ttaaaggaaactacatatgatccacatgatcagat |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||| |||||| |
|
|
| T |
33299782 |
gtgataacatgtaccctcagattttgctcttataaattagaggatgaagatcattctgagtttaattaaaggaaactacatattatccacatgttcagat |
33299881 |
T |
|
| Q |
209 |
g |
209 |
Q |
| |
|
| |
|
|
| T |
33299882 |
g |
33299882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University