View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19390_high_10 (Length: 283)

Name: NF19390_high_10
Description: NF19390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19390_high_10
NF19390_high_10
[»] chr3 (1 HSPs)
chr3 (16-267)||(49123778-49124029)
[»] chr4 (1 HSPs)
chr4 (132-245)||(4271627-4271743)
[»] chr1 (1 HSPs)
chr1 (132-245)||(2807971-2808087)


Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 16 - 267
Target Start/End: Complemental strand, 49124029 - 49123778
Alignment:
16 caaacttcaatgccaaggtaaaaaactgaatttactatatattttatcttcttccacaaagtattttattcaccaaagtttcttatcaattgacacccac 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49124029 caaacttcaatgccaaggtaaaaaactgaatttactatatattttatcttcttccacaaagtattttattcaccaaagtttcttatcaattgacacccac 49123930  T
116 ccacgtacttattggcggtggattcagctctctgattttggtctgtccataattgatgggtcccaaaagaagaacatcaaggtttcaggaacattgggat 215  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49123929 ccacgtactaattggcggtggattcagctctctgattttggtctgtccataattgatgggtcccaaaagaagaacatcaaggtttcaggaacattgggat 49123830  T
216 acgtagccccagaatatcttttagatggtaatgccaactaaacttgttatta 267  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
49123829 acgtagccccagaatatcttttagatggtaatgccaactaaacttgttatta 49123778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 132 - 245
Target Start/End: Original strand, 4271627 - 4271743
Alignment:
132 ggtggattcagctctctgattttggtctgtccataattgatgggtcccaaaagaagaa---catcaaggtttcaggaacattgggatacgtagccccaga 228  Q
    |||| |||||||| ||||||||||||||  | |||| |||||||||||| || |||||   ||||||| ||||||| |||||||| || || ||||||||    
4271627 ggtgaattcagctttctgattttggtcttgcaataactgatgggtcccagaacaagaataacatcaagctttcaggcacattggggtatgttgccccaga 4271726  T
229 atatcttttagatggta 245  Q
     ||||||||||||||||    
4271727 gtatcttttagatggta 4271743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 132 - 245
Target Start/End: Original strand, 2807971 - 2808087
Alignment:
132 ggtggattcagctctctgattttggtctgtccataattgatgggtcccaaaagaagaa---catcaaggtttcaggaacattgggatacgtagccccaga 228  Q
    |||| |||||||| ||||||||||||||  | |||| ||||||||||||||| |||||   ||||||| ||||||| |||||||| || || ||||| ||    
2807971 ggtgaattcagctttctgattttggtcttgcaataactgatgggtcccaaaacaagaataacatcaagctttcaggcacattggggtatgttgccccgga 2808070  T
229 atatcttttagatggta 245  Q
     ||||||||||||||||    
2808071 gtatcttttagatggta 2808087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University