View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19391_high_11 (Length: 310)
Name: NF19391_high_11
Description: NF19391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19391_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 16 - 298
Target Start/End: Complemental strand, 13114486 - 13114203
Alignment:
| Q |
16 |
catttgggggcaatgacagagcgagtaagattctaaccaatgcatgttattgttgtttgaaaactatttctaaacctccgcttaggtctaagtttcgctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
13114486 |
catttgggggcaatgacagagcgagtgagattctaaccaatgcatgttattgttgtttgaaaactatttcgaaacctccgcttaggtctaagtttcggtt |
13114387 |
T |
|
| Q |
116 |
agacctttaagaattttgggaaagactcccttttgaggatagcctgtttaaaaa-gatattgattgatgagtttgttcgaattgcagattgttgtttggt |
214 |
Q |
| |
|
||||| || |||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13114386 |
agacccttgagaatttttggaaagactcccttttgaggatagcctgtttaaaaaagatattgattgatgagtttgttcgaattgcagattgttgtttggt |
13114287 |
T |
|
| Q |
215 |
tagtaattccagcgagtagaggcacaaaaagtgatcatggcaacaacaatcttgcactttttgttcttattcagtatgttccta |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13114286 |
tagtaattccagcgagtagaggcacaaaaagtgatcatgccaacaacaatcttgcactttttgttcttattcagtatgttccta |
13114203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University