View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19391_high_21 (Length: 204)
Name: NF19391_high_21
Description: NF19391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19391_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 16 - 122
Target Start/End: Complemental strand, 30810610 - 30810504
Alignment:
| Q |
16 |
atgaacagaaaccccagcactatccaaattctgatgattgctagaattatgtataagctccgaaactttattcaatctcatctgcaaccacaagttccca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30810610 |
atgaacagaaaccccagcactatccaaattctgatgattgctagaattatgtataagctccgaaactttattcaatctcatctgcaaccacaagttccca |
30810511 |
T |
 |
| Q |
116 |
attaaac |
122 |
Q |
| |
|
||||||| |
|
|
| T |
30810510 |
attaaac |
30810504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 133 - 185
Target Start/End: Complemental strand, 30810469 - 30810417
Alignment:
| Q |
133 |
ctttccaagcacgaattactttctagaatattctcaaaaacgcacctgcttgg |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30810469 |
ctttccaagcacgaattactttctagaatattctcaaaaacgcacctgcttgg |
30810417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 102
Target Start/End: Complemental strand, 36130500 - 36130417
Alignment:
| Q |
19 |
aacagaaaccccagcactatccaaattctgatgattgctagaattatgtataagctccgaaactttattcaatctcatctgcaa |
102 |
Q |
| |
|
|||||||||| |||||||||||||||| || |||| | ||||||| |||||||||||||||||||| ||||||| | ||||||| |
|
|
| T |
36130500 |
aacagaaacctcagcactatccaaattgtggtgatcggtagaattgtgtataagctccgaaactttgttcaatcgcctctgcaa |
36130417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University