View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19391_high_9 (Length: 336)
Name: NF19391_high_9
Description: NF19391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19391_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 2666558 - 2666255
Alignment:
| Q |
1 |
gtagcagttttctagtacttattttgctgaacacttaccaagacataagatttttatcccacaaaaagctgttatttatattaacaaaaaatattgtgta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2666558 |
gtagcagttttctagtacttattttgctgaatacttactaagacataagatttttatcccacaaaaagctgttatgtatattaacaaaaaatattgtgta |
2666459 |
T |
 |
| Q |
101 |
acatgtatcatttacattcaagatgataaatcttcccctcaaaagatgataaatcttgagcaagaaaatggaagaattaggttgaatgaatgaaaaatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2666458 |
--------------cattcaagatgataaatcttcccctcaaaagatgataaatcttgagcaaaaaaatggaagaattaggttgagtgaatgaaaaatat |
2666373 |
T |
 |
| Q |
201 |
acagatagaaattgtgaatgatatttattgtacctcagttctgcccatggtttcaccagctttgtaactttggtcgtgggatgccatttttctttttcaa |
300 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2666372 |
agagatagaaattgtgaatgatatttattgtacctcagttctgcccatggtttcaccagctttgtaactttggtcgtgggaagccatttttctttttcaa |
2666273 |
T |
 |
| Q |
301 |
attgaattagcaggttta |
318 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
2666272 |
attgaaatagcaggttta |
2666255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 213 - 302
Target Start/End: Complemental strand, 2681769 - 2681679
Alignment:
| Q |
213 |
tgtgaatgatattta-ttgtacctcagttctgcccatggtttcaccagctttgtaactttggtcgtgggatgccatttttctttttcaaat |
302 |
Q |
| |
|
|||||||||||||| || ||||||||||| |||||||||||||||||||||||| || || | |||||||||||| |||||| ||||||| |
|
|
| T |
2681769 |
tgtgaatgatattttgttatacctcagttcggcccatggtttcaccagctttgtagctctgattgtgggatgccatctttcttcttcaaat |
2681679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 231 - 302
Target Start/End: Complemental strand, 2675439 - 2675368
Alignment:
| Q |
231 |
tacctcagttctgcccatggtttcaccagctttgtaactttggtcgtgggatgccatttttctttttcaaat |
302 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| | || || || ||||||||||| |||||| ||||||| |
|
|
| T |
2675439 |
tacctcagttcgacccatggtctcaccagctttgaagctctgatcttgggatgccatctttcttcttcaaat |
2675368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University